AKT-mTOR signaling-mediated rescue of PRKAG2 R302Q mutant-induced familial hypertrophic cardiomyopathy by treatment with β-adrenergic receptor (β-AR) blocker metoprolol
Introduction
Hypertrophic cardiomyopathy (HCM) is the most common inherited cardiac disorder with characteristics of increased ventricular wall thickness, cardiomyocyte hypertrophy and myocardial fibrosis (1). PRKAG2 cardiac syndrome, as a common form of metabolic HCM caused by mutations in the PRKAG2 gene encoding the AMPKγ2 subunit, often shows abnormal glycogen deposition in cardiomyocytes, ventricular preexcitation and progressive cardiac conduction disturbances in addition to myocardial hypertrophy (2). AMPK is a heterotrimeric protein composed of α, β, and γ subunits, acting as the key enzyme responsible for regulating cellular energy homeostasis. AMPK activation turns on the catabolic pathway to produce ATP and turns off the anabolic pathway that requires adenosine-triphosphate (ATP) consumption, maintaining the dynamic energy balance (3). Genetic mutants (MUT) in PRKAG2 have been demonstrated to cause inappropriate activation of AMPK, leading to arrhythmias and cardiac insufficiency. For example, elevated activity of AMPK and decreased sensitivity to adenosine monophosphate (AMP) were reported in the cardiomyocytes with PRKAG2 K475E MUT and in the myocardium of PRKAG2 N488I MUT mice, associated with activation of mTOR/p70S6K/4EBP1 and/or Akt-mTOR-FOXO3A pathways (4,5). In consistence, PRKAG2 MUT-induced myocardial hypertrophy can be rescued by application of the mTOR inhibitor rapamycin.
The β-adrenergic receptor (β-AR) signaling pathway is one of the pathways mediating induction of cardiac hypertrophy, which has been suggested to be associated with signaling pathways such as cyclic adenosine monophosphate (cAMP)-protein kinase A (PKA). A phosphoproteomic analysis in vivo revealed that the kinases AMPK, AKT, and mTOR are also involved in β-AR signaling regulation of HCM (6). In addition, β-AR showed regulation of glucose uptake and glycogen synthesis (7). β1-AR agonists reduced insulin-induced glucose uptake and glycogen synthesis (8). Glycogen storage in cardiomyocytes has been shown to be related with myocardial hypertrophy. Reduction of glycogen was associated with improvement of cardiac function, suggesting the therapeutic values for HCM of preventing glucose uptake by cardiomyocytes. However, Kim et al found that inhibition of glycogen deposition in N488I mutation model reversed ventricular preexcitation but showed limited effect on rescuing cardiac hypertrophy, suggesting the correlation between myocardial hypertrophy and glycogen storage might be in a genetic disorder-dependent manner (4).
To date, effects of all kinds of clinic treatment to PRKAG2 cardiac syndrome patients remain very limited yet mainly due to lacking of a well-accepted management guideline for the disease. Metoprolol, as a selective β1-AR blocker, interacts with β1-AR to inhibit β1-AR signaling, leading to improvement of myocardial remodeling, and rescue of cardiac hypertrophy caused by infarction or hypertension (9,10). Our previous study treated 5 patients in a PRKAG2 R302Q-induced HCM family with a long-term oral administration of metoprolol, resulting in significant prevention of myocardial hypertrophy progression (11). However, the regulatory mechanism remains unclear.
In order to validate the function and mechanism of β-blocker in regulating myocardial hypertrophy, a fluorescent-labeled adenoviral virus carrying either wild type (WT) or R302Q MUT of PRKAG2 gene was infected into neonatal rat cardiomyocytes (NRCMs) and H9C2 cell line, followed by analyses of AMPK activity, cellular hypertrophy, glycogen storage and cell proliferation with or without treatment of metoprolol or PKA inhibitor H89. The activity of AKT-mTOR signaling was assessed as well. As a result, increased AMPK activity was indicated in the PRKAG2 R302Q-overexpressing cells, accompanied with increase of glycogen storage, cell size and expression levels of myocardial hypertrophy markers atrial natriuretic peptide (ANP), brain natriuretic peptide (BNP) and β-myosin heavy chain (β-MHC). Phosphorylation of AKT, mTOR, p70S6K and 4EBP1 was suggested to mediate the PRKAG2 R302Q-induced HCM phenotype. The current study not only determined the mechanism regulating HCM induction by PRKAG2 R302Q MUT, but also demonstrated a therapeutic strategy using β-AR blocker to treat the patients. We present the following article in accordance with the MADR reporting checklist (available at https://cdt.amegroups.com/article/view/10.21037/cdt-22-81/rc).
Methods
Reagents
The following primary antibodies were used in our experiments: anti-β-actin (#3700), anti-AMPKα (#2535), anti-phospho-AMPKα (#5831), anti-mTOR (#2983), anti-phospho-mTOR (#2971), anti-4E-BP1 (#9644), anti-phospho-4E-BP1 (#2855), anti-P70S6K (#2708), and anti-phospho-P70S6K (#9208) were purchased from Cell Signaling Technology (USA). Primary antibodies were diluted 1:2,000 for hybridization. 1:8,000 dilution was applied to the second antibody. BCA protein assay kit was purchased from Beyotime (Beyotime, Shanghai, China).
Cardiomyocyte cell culture and transduction
H9C2 cells (ATCC, Manassas, VA, USA) were cultured in DMEM (Hyclone, Logan, UT, USA), supplemented with 10% FBS (Gibco, Grand Island, NY, USA), and 1% penicillin-streptomycin (Gibco) at 5% CO2 and 37 ℃. NRCMs were isolated from the heart of newborn (1 day old) rat with PBS containing 0.01% collagenase type II. The cardiomyocytes were then seeded at a density of 1×106 cells/well in six-well culture plates coated with fibronectin in plating medium, which consisted of F12 medium supplemented with 10% fetal calf serum and penicillin/streptomycin. Cells were grown to 70% confluence before transduction with PRKAG2 gene γ2WT- (Adγ2WT), or γ2 R302Q- (Adγ2R302Q) overexpressing adenoviruses at a multiplicity of transduction of 36. Then, H89 (10 μM) and metoprolol (20 μM) were administered to intervene the cells respectively, and the cells were harvested after 48 h for further analysis.
AMPK activity analysis
To assess the effect of PRKAG2 R302Q MUT on the activity of AMPK, a cell AMPK Kinase Activity Colorimetric Quantitative Detection Kit (Haring Creature, China) was used following the manufacturer’s instructions. Mean values of the absorbance from triplicates were calculated for each sample.
Cellular glycogen analysis
Glycogen staining was performed using a periodic acid-Schiff kit (PAS, Beyotime, China). The amount of glycogen storage in cells was quantified using a glycogen content assay kit (Solarbio, BC0340, China) according to the manufacturer’s instructions.
Immunofluorescence analysis
Cells were fixed with 3.7% formaldehyde for 15 min, permeabilized with 0.1% Triton X-100 in PBS for 40 min, blocked with a 10% BSA solution for 1 h at room temperature and then incubated with a primary antibody (1:50 dilution). Nuclei were stained with DAPI (Invitrogen, USA) for 10 min in the dark. Images were taken with a fluorescence confocal microscope. Image-Pro Plus 6.0 software was used for quantitative analysis.
Cell proliferation assay
Cell proliferation was analyzed using cell counting kit-8 (CCK-8, Beyotime, China) according to the manufacturer’s instructions. For each group, mean values of the absorbance from three wells were calculated. EdU staining was performed using an EdU kit (BeyoClickTM EdU Cell Proliferation Kit with Alexa Fluor 488, Beyotime, China). Briefly, harvested cells were seeded in 24-well plates. Subsequently, cells were incubated with EdU for 3 h, fixed with 4% paraformaldehyde for 15 min, and permeated with 0.3% Triton X-100 for another 15 min. Then cells were incubated with the Click Reaction Mixture for 30 min at room temperature in a dark place and then incubated with Hoechst 33342 for 10 min.
Quantitative real-time polymerase chain reaction (qRT-PCR)
Total RNA was isolated using Trizol Reagent (Invitrogen, USA). First Strand cDNA Synthesis Kit (Roche, USA) was used to synthesize cDNA. The mRNA levels of the indicated genes were quantified with real-time PCR using SYBR Green (Roche, USA). Sequence of primers (5' to 3') are: ANP, forward CGGAAGCTGTTGCAGCCTA, reverse GCCCTGAGCGAGCAGACCGA; BNP, forward TTTGGGCAGAAGATAGACCG, reverse TGGCAAGTTTGTGCTGGAA; β-MHC, forward GCCTACCTCATGGGACTGAA, reverse ACATTCTGCCCTTTGGTGAC; GAPDH, forward AGTGCCAGCCTCGTCTCAT, reverse AGGGGCCATCCACAGTCTTC.
Western blotting
Whole cell lysates were obtained by homogenizing cells in RIPA buffer. Thirty μg of protein lysate was separated via running SDS-PAGE. PVDF membrane (Millipore, Massachusetts, USA) was used for transfer. Ten-percent non-fat milk was used for blocking. Primary antibodies were applied for incubation overnight at 4 ℃, followed by an incubation with secondary antibody for 1.5 h at room temperature. ECL reagents (170-5061, Bio-Rad, Shanghai, China) were applied for bands staining. Fluor Chem E imager (Cell Biosciences, Santa Clara,USA) was used to capture images.
Statistical analysis
The data are represented as the mean ± standard deviation (SD). Student’s two-tailed t-test was used for statistical analysis using SPSS software (version 17.0, SPSS Inc., Chicago, IL, USA). P<0.05 was considered a statistically significant difference.
Results
Treatment of a PRKAG2 gene cardiac syndrome family line with the β1-AR blocker metoprolol
In our previous published article, a PRKAG2 (R302Q) cardiac syndrome family line was followed for a long period and five family members were diagnosed with PRKAG2 cardiac syndrome presenting with complete atrioventricular (AV) block and asymmetric septal hypertrophy (11) (Figure S1). The five patients were treated with metoprolol, during which the patients were regularly reviewed. By comparing cardiac ultrasound before and after medication in the five patients, we found that the progression of myocardial hypertrophy was significantly delayed in all patients after metoprolol treatment (Table S1) and that the mean annual rate of increase in septal thickness decreased, accompanied by an increase in left ventricular end-diastolic dimension (LVEDD).
Activation of AMPK in cardiomyocytes by overexpression of PRKAG2 gene R302Q
In order to determine the regulation of AMPK activity by PRKAG2 R302Q MUT in cardiomyocytes, WT or R302Q MUT PRKAG2 gene were cloned into an adenovirus vector, and then transduced into primary NRCMs for further analysis (Figure 1A, Figure S2). AMPK activity showed upregulation by both WT and MUT PRKAG2 (Figure 1B). In consistence, phosphorylation of AMPK was promoted by both WT and MUT PRKAG2 (Figure 1C). Notably, MUT PRKAG2 promoted phosphorylation of AMPK and activity of AMPK with a higher level than WT PRKAG2 (Figure 1B,1C).
PRKAG2 gene R302Q induced myocardial hypertrophy and glycogen storage in cardiomyocytes
In order to determine the mechanism regulating PRKAG2 R302Q MUT-induced myocardial hypertrophy, NRCMs and H9C2 cells overexpressing WT or MUT PRKAG2 were analyzed with myocardial hypertrophy, cell proliferation and glycogen storage. Cell hypertrophy showed induction by MUT PRKAG2, which was measured through α-SMA staining (Figure 2A,2B). Glycogen storage in cardiomyocytes was increased by WT or MUT PRKAG2 (Figure 2C,2D). In consistence, increased expression levels of myocardial hypertrophy markers, such as ANP, BNP and β-MHC, were observed in those cells (Figure 2E). To determine the regulation of cell proliferation by PRKAG2, both EdU staining and CCK8 assay were applied to the cardiomyocytes. As shown in Figure 2F-2H, PRKAG2 overexpression significantly promoted the proliferation of cardiomyocytes. Notably, MUT PRKAG2 promoted cellular hypertrophy, glycogen deposition and cell proliferation at higher levels than WT PRKAG2.
Rescue of PRKAG2 gene R302Q-induced myocardial hypertrophy by β1-AR blocker and PKA inhibitor
In order to validate the therapeutic effects and explore the mechanisms of β1-AR blockers to cure the patients with PRKAG2 cardiac syndrome, either β1-AR blocker metoprolol or PKA inhibitor H89 was applied to the PRKAG2 R302Q MUT-expressing cardiomyocytes, followed by analysis of cellular hypertrophy, glycogen storage and cell proliferation. As shown in Figure 3, both metoprolol or H89 treatment can partly or completely rescue the PRKAG2 R302Q MUT-induced phenotypes including AMPK activity (Figure 3A), cellular size (Figure 3B,3C), glycogen storage (Figure 3D,3E), expression levels of ANP, BNP and β-MHC (Figure 3F), and cell proliferation (Figure 3G-3I). In order to exclude the effect of drugs on the cell status, we also detected the changes in cell viability, the results showed that the two drugs did not affect the cell viability significantly decreased (Figure S3).
PRKAG2 R302Q activated AKT-mTOR signaling in cardiomyocytes
In order to explore the molecular mechanisms through which PRKAG2 R302Q induces myocardial hypertrophy, we firstly analyzed AKT-mTOR signaling in cardiomyocytes overexpressing WT or MUT PRKAG2. As shown in Figure 4A-4D, MUT PRKAG2 significantly activated AKT-mTOR signaling by promoting the phosphorylation levels of AKT, mTOR and downstream target genes p70S6K and 4EBP1. In consistence with the cellular phenotypes in Figure 4, both β1-AR blocker metoprolol and PKA inhibitor H89 treatment reversed the MUT PRKAG2-induced phosphorylation of AKT, mTOR, p70S6K and 4EBP1 (Figure 4E,4F,4H).
Discussion
As a highly genetically heterogeneous disease, 50–60% of HCM are caused by mutations in myosin genes (12). Recent evidence indicated that metabolism-related MUT can also result in myocardial hypertrophy, called “metabolic HCM”. PRKAG2 cardiac syndrome is a typical form of metabolic HCM caused by mutations in the PRKAG2 gene, which encodes the γ2 subunit of AMPK (13). PRKAG2 cardiac syndrome has a high incidence of sudden cardiac death (14,15). However, there is still no official guidelines available for management and treatment of PRKAG2 cardiac syndrome (16). As described in our recent publication, a family with PRKAG2 R302Q MUT were diagnosed as PRKAG2 cardiac syndrome, showing complete AV block and asymmetric ventricular septal hypertrophy (11) (Table S1, Figure S1). Metoprolol, as a selective β1-AR blocker, was applied to these patients for a long-term treatment. As a result, progression of the cardiac hypertrophy was significantly postponed in all the patients upon metoprolol treatment, including decreased ventricular hypertrophy rate measured by the thickness of the intraventricular septum (IVSth) and increased size of LVEDD. In the present study, we are the first to apply β1-AR blocker metoprolol to five patients with PRKAG2 cardiac syndrome, resulting in great therapeutic effects. In vitro studies using NRCMs and H9C2 cell line demonstrated rescue of the PRKAG2 R302Q-induced cardiomyocyte hypertrophy and glycogen storage by treatment with β-AR inhibitors. Furthermore, AKT-mTOR signaling pathway was demonstrated to involve in the regulation of PRKAG2 cardiac syndrome. AKT is a serine/threonine kinase involved in the regulation of multiple cellular functions, including metabolism, glucose uptake, proliferation and protein synthesis (17,18). In the heart, mTOR is a large-molecule serine-threonine protein kinase that is activated by phosphorylation of TSC2 by AKT (19). Activation of mTOR leads to increased proliferation and elevated size of cardiomyocytes, which are associated with cardiac hypertrophy (20). p70S6K and 4EBP1, as two of the main target genes downstream of mTOR, are important regulators of protein synthesis in the heart (21,22). In the current study, overexpression of PRKAG2 R302Q in cardiomyocytes activated AKT-mTOR-p70S6K/4EBP1 signaling, leading to increased cell size and promoted cell proliferation (Figure 4).
The cardio-protective effects of β-blockers have been well defined in treatment of patients with coronary heart disease, heart failure, and hypertension, showing clinical outcomes including anti-myocardial ischemia, anti-hypertension, anti-arrhythmias, and increased left ventricular ejection fraction (23,24). In the model of pressure overload-induced myocardial hypertrophy, β1-AR was highly activated and enriched in the heart, accounting for about 70% of the total cardiac β-ARs (25). Continuous activation of β1-AR led to myocardial remodeling, myocardial hypertrophy and even heart failure (26). In consistence, metoprolol showed therapeutic effects here in our study to PRKAG2 R302Q-induced HCM, adding a node to the regulatory network between β-blockers and heart diseases.
Abnormal activation of AMPK has been considered as a main reason causing myocardial hypertrophy, cardiac conduction disturbances, arrhythmias and even sudden death (27,28). Contradictory results about the effect of PRKAG2 MUT on the AMPK activity were reported. Introduction of PRKAG2 MUT into CCL13 cell line decreased the AMPK activity (29). However, PRKAG2 cardiac syndrome was shown in the PRKAG2 MUT-transgenic mice, associated with increased AMPK activity in the heart of young mice and decreased sensitivity to AMP (30). In consistence, here we demonstrated activation of AMPK by PRKAG2 R302Q in cardiomyocytes.
This is the mechanism study to our previous publication of clinical observations in 5 patients from a PRKAG2 R302Q-induced HCM family (11). There are still quite a few limitations in the current study. First, this study was based on a small sample size of clinical patients, which did not meet the condition to carry out a randomized controlled trial (RCT) design. Second, the myocardial magnetic resonance imaging (MRI) and myocardial biopsy from the patients were not obtained. Third, the follow-up validation experiments such as transgenic animal models and intervention study in vivo were lacking. In order to overcome these shortages, we are planning to establish the induced pluripotent stem cells from the blood cells of the patients, and establish PRKAG2 R302Q transgenic mice to perform further study. In addition, we will continue to follow up the family patients to validate the therapeutic effects of β-blockers.
In conclusion, the current study demonstrated that application of β1-AR blocker metoprolol is able to ameliorate or even reverse myocardial hypertrophy and glycogen storage induced by PAKAG2 R302Q MUT via PKA inhibiting activation of the AKT-mTOR signaling pathway, suggesting the potential of metoprolol to be developed as a clinical first-line drug in treatment of PRKAG2 cardiac syndrome. Nevertheless, there is no doubt that further study through clinical trials will be still required to confirm the therapeutic effects and administrative strategy.
Acknowledgments
We sincerely express our gratitude to Zuoren Yu for his guidance on this project.
Funding: This work was supported by the Key Project of Nantong Science and Technology Bureau (No. MS22020008); Youth Science Fund Project (No. 82000380).
Footnote
Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://cdt.amegroups.com/article/view/10.21037/cdt-22-81/rc
Data Sharing Statement: Available at https://cdt.amegroups.com/article/view/10.21037/cdt-22-81/dss
Peer Review File: Available at https://cdt.amegroups.com/article/view/10.21037/cdt-22-81/prf
Conflicts of interest: All authors have completed the ICMJE uniform disclosure form (available at https://cdt.amegroups.com/article/view/10.21037/cdt-22-81/coif). The authors have no conflicts of interest to declare.
Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved.
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Marian AJ. Molecular Genetic Basis of Hypertrophic Cardiomyopathy. Circ Res 2021;128:1533-53. [Crossref] [PubMed]
- Yavari A, Sarma D, Sternick EB. Human γ2-AMPK Mutations. Methods Mol Biol 2018;1732:581-619. [Crossref] [PubMed]
- Samanta J, Mondal A, Saha S, et al. Oleic Acid Protects from Arsenic-Induced Cardiac Hypertrophy via AMPK/FoxO/NFATc3 Pathway. Cardiovasc Toxicol 2020;20:261-80. [Crossref] [PubMed]
- Kim M, Hunter RW, Garcia-Menendez L, et al. Mutation in the γ2-subunit of AMP-activated protein kinase stimulates cardiomyocyte proliferation and hypertrophy independent of glycogen storage. Circ Res 2014;114:966-75. [Crossref] [PubMed]
- Xu Y, Gray A, Hardie DG, et al. A novel, de novo mutation in the PRKAG2 gene: infantile-onset phenotype and the signaling pathway involved. Am J Physiol Heart Circ Physiol 2017;313:H283-92. [Crossref] [PubMed]
- Meyer EE, Clancy CE, Lewis TJ. Dynamics of adrenergic signaling in cardiac myocytes and implications for pharmacological treatment. J Theor Biol 2021;519:110619. [Crossref] [PubMed]
- Alcántara-Hernández R, Carmona-Rosas G, Hernández-Espinosa DA, et al. Glycogen Synthase Kinase-3 modulates α1A-adrenergic receptor action and regulation. Eur J Cell Biol 2020;99:151072. [Crossref] [PubMed]
- Ashraf S, Ashraf N, Yilmaz G, et al. Crosstalk between beta-adrenergic and insulin signaling mediates mechanistic target of rapamycin hyperactivation in liver of high-fat diet-fed male mice. Physiol Rep 2021;9:e14958. [Crossref] [PubMed]
- Holt A, Blanche P, Zareini B, et al. Effect of long-term beta-blocker treatment following myocardial infarction among stable, optimally treated patients without heart failure in the reperfusion era: a Danish, nationwide cohort study. Eur Heart J 2021;42:907-14. [Crossref] [PubMed]
- de Boer RA, Heymans S, Backs J, et al. Targeted therapies in genetic dilated and hypertrophic cardiomyopathies: from molecular mechanisms to therapeutic targets. A position paper from the Heart Failure Association (HFA) and the Working Group on Myocardial Function of the European Society of Cardiology (ESC). Eur J Heart Fail 2022;24:406-20. [Crossref] [PubMed]
- Lu W, Sheng H. Treatment of myocardial hypertrophy in patients with PRKAG2 cardiac syndrome. Chinese Journal of Heart Failure and Cardiomyopathy 2021;5:91-6.
- Ma S, Jiang W, Liu X, et al. Efficient Correction of a Hypertrophic Cardiomyopathy Mutation by ABEmax-NG. Circ Res 2021;129:895-908. [Crossref] [PubMed]
- Banankhah P, Fishbein GA, Dota A, et al. Cardiac manifestations of PRKAG2 mutation. BMC Med Genet 2018;19:1. [Crossref] [PubMed]
- Hu D, Hu D, Liu L, et al. Identification, clinical manifestation and structural mechanisms of mutations in AMPK associated cardiac glycogen storage disease. EBioMedicine 2020;54:102723. [Crossref] [PubMed]
- Austin SL, Chiou A, Sun B, et al. Alglucosidase alfa enzyme replacement therapy as a therapeutic approach for a patient presenting with a PRKAG2 mutation. Mol Genet Metab 2017;120:96-100. [Crossref] [PubMed]
- Porto AG, Brun F, Severini GM, et al. Clinical Spectrum of PRKAG2 Syndrome. Circ Arrhythm Electrophysiol 2016;9:e003121. [Crossref] [PubMed]
- Qin W, Cao L, Massey IY. Role of PI3K/Akt signaling pathway in cardiac fibrosis. Mol Cell Biochem 2021;476:4045-59. [Crossref] [PubMed]
- Yuan W, Wang X. Propranolol Participates in the Treatment of Infantile Hemangioma by Inhibiting HUVECs Proliferation, Migration, Invasion, and Tube Formation. Biomed Res Int 2021;2021:6636891. [Crossref] [PubMed]
- Shams R, Ito Y, Miyatake H. Mapping of mTOR drug targets: Featured platforms for anti-cancer drug discovery. Pharmacol Ther 2022;232:108012. [Crossref] [PubMed]
- Daneshgar N, Rabinovitch PS, Dai DF. TOR Signaling Pathway in Cardiac Aging and Heart Failure. Biomolecules 2021;11:168. [Crossref] [PubMed]
- Liu D, Bordicchia M, Zhang C, et al. Activation of mTORC1 is essential for β-adrenergic stimulation of adipose browning. J Clin Invest 2016;126:1704-16. [Crossref] [PubMed]
- Chen Y, Liu Z, Hu Z, et al. Tripartite motif 27 promotes cardiac hypertrophy via PTEN/Akt/mTOR signal pathways. Bioengineered 2022;13:8323-33. [Crossref] [PubMed]
- Arero AG, Vasheghani-Farahani A, Soltani D. Meta-Analysis of the Usefulness of Beta-Blockers to Reduce the Risk of Major Adverse Cardiovascular Events in Patients With Stable Coronary Artery Disease Without Prior Myocardial Infarction or Left Ventricular Dysfunction. Am J Cardiol 2021;158:23-9. [Crossref] [PubMed]
- Zhu J, Chen N, Zhou M, et al. Calcium channel blockers versus other classes of drugs for hypertension. Cochrane Database Syst Rev 2022;1:CD003654. [PubMed]
- Vrablik M, Corsini A, Tůmová E. Beta-blockers for Atherosclerosis Prevention: a Missed Opportunity? Curr Atheroscler Rep 2022;24:161-9. [Crossref] [PubMed]
- McDonough CW, Warren HR, Jack JR, et al. Adverse Cardiovascular Outcomes and Antihypertensive Treatment: A Genome-Wide Interaction Meta-Analysis in the International Consortium for Antihypertensive Pharmacogenomics Studies. Clin Pharmacol Ther 2021;110:723-32. [Crossref] [PubMed]
- Miyamoto L. Molecular Pathogenesis of Familial Wolff-Parkinson-White Syndrome. J Med Invest 2018;65:1-8. [Crossref] [PubMed]
- Randrianarisoa E, Lehn-Stefan A, Krier J, et al. AMPK Subunits Harbor Largely Nonoverlapping Genetic Determinants for Body Fat Mass, Glucose Metabolism, and Cholesterol Metabolism. J Clin Endocrinol Metab 2020;105:dgz020. [Crossref] [PubMed]
- Scott JW, Hawley SA, Green KA, et al. CBS domains form energy-sensing modules whose binding of adenosine ligands is disrupted by disease mutations. J Clin Invest 2004;113:274-84. [Crossref] [PubMed]
- Banerjee SK, McGaffin KR, Huang XN, et al. Activation of cardiac hypertrophic signaling pathways in a transgenic mouse with the human PRKAG2 Thr400Asn mutation. Biochim Biophys Acta 2010;1802:284-91. [Crossref] [PubMed]

