Ginsenoside Rb2 alleviates myocardial ischemia/reperfusion injury through IKKα lactylation regulation of macrophage polarization
Highlight box
Key findings
• Ginsenoside Rb2 (Rb2) directly binds to inhibitor of kappa B kinase (IKKα) and inhibits its lactylation at the K617 site.
• Rb2 destabilizes IKKα protein, suppresses NF-κB signaling, and promotes anti-inflammatory M2 macrophage polarization.
• In a murine myocardial ischemia/reperfusion injury (MIRI) model, Rb2 pretreatment (10 mg/kg for 14 days) significantly improves cardiac function (left ventricular ejection fraction, left ventricular fractional shortening), reduces infarct size, and lowers serum cardiac troponin T levels.
• IKKα overexpression reverses the protective effects of Rb2, confirming IKKα as a critical downstream target.
What is known and what is new?
• MIRI is driven by inflammatory responses and macrophage imbalance (M1 pro-inflammatory vs. M2 reparative). Rb2 has cardioprotective and anti-inflammatory properties, and protein lactylation is emerging as a key metabolic-inflammatory link in cardiovascular disease.
• This is the first study to demonstrate that Rb2 directly targets IKKα lactylation at K617. It reveals that inhibiting this specific post-translational modification destabilizes IKKα, shifts macrophage polarization toward M2, and alleviates MIRI—a previously unrecognized mechanism for Rb2.
What is the implication, and what should change now?
• IKKα K617 lactylation is identified as a novel therapeutic node in MIRI. Rb2, a natural compound with a favorable safety profile, could serve as a lead candidate for modulating protein lactylation in ischemic heart disease.
• Future studies should focus on: (I) identifying the lactyltransferase(s) responsible for IKKα K617 modification; (II) testing post-ischemic (rather than only pretreatment) Rb2 administration in large-animal models; (III) validating the role of IKKα lactylation in other inflammatory cardiovascular conditions; and (IV) conducting rigorous dose optimization and pharmacokinetic studies to support clinical translation.
Introduction
Background
Myocardial ischemia/reperfusion (I/R) injury (MIRI) remains a critical challenge in cardiovascular medicine, characterized by exacerbated cardiac damage upon blood flow restoration after prolonged ischemia, which triggers oxidative stress, inflammation, and cardiomyocyte death (1). This phenomenon is a major complication in acute myocardial infarction (AMI) and cardiac surgeries, affecting millions worldwide and contributing to high mortality rates (2). Risk factors such as aging, diabetes, hypertension, and atherosclerosis further amplify its clinical burden. Current interventions, including pharmacological agents (e.g., antiplatelet drugs, statins, beta-blockers) and mechanical reperfusion, often fail to fully mitigate I/R injury due to their limited ability to address the complex oxidative and inflammatory cascades (3). Additionally, these therapies may have adverse effects or limited accessibility in resource-constrained settings, necessitating the exploration of alternative, multi-target therapeutic strategies.
Natural compounds derived from traditional Chinese medicine (TCM) have emerged as promising candidates due to their ability to modulate key pathological pathways in MIRI-such as oxidative stress, apoptosis, and inflammation-with minimal toxicity (4-6). Exploring TCM compounds could thus provide novel, cost-effective, and complementary strategies to ameliorate MIRI and improve clinical outcomes. Among these, ginsenoside Rb2 (Rb2), a protopanaxadiol-type saponin from Panax ginseng, has garnered attention for its broad pharmacological activities. Rb2 has demonstrated significant anti-cancer activity in various tumor cell lines and animal models. For instance, it exerts anti-tumor effects through multiple mechanisms such as regulating the cell cycle, inducing apoptosis of cancer cells, inhibiting the formation of new blood vessels in tumors, and modulating the immune microenvironment (7-9). In addition, Rb2 improves the cognitive impairment in Alzheimer’s disease model mice, and its mechanism might be related to promoting neurogenesis and protecting nerve cells (10). In cardiovascular contexts, Rb2 has been shown to ameliorate atherosclerosis by regulating macrophage polarization (11) and improve heart failure by inhibiting microRNA (miR)-216a-5p to promote autophagy (12). Although recent studies have reported that Rb2 can attenuate MIRI by activating SIRT1-mediated signaling pathways (13), the detailed molecular mechanisms, particularly those involving post-translational modifications such as lactylation in the regulation of macrophage polarization during MIRI, have not been fully elucidated.
Rationale and knowledge gap
Macrophage polarization refers to the process by which macrophages differentiate into distinct functional phenotypes, primarily the pro-inflammatory M1 type and the anti-inflammatory M2 type, in response to different microenvironmental stimuli (14). Research has demonstrated its critical role in various diseases. In cancer, M2 macrophages promote tumor progression by suppressing immune responses, while M1 macrophages exhibit anti-tumor activity (14). In autoimmune diseases such as rheumatoid arthritis, M1 macrophages drive tissue inflammation and damage (15). In cardiovascular diseases (CVDs), macrophage polarization plays a pivotal role. In atherosclerosis, M1 macrophages exacerbate plaque inflammation and instability, while M2 macrophages contribute to plaque stabilization and tissue repair (16). Following myocardial infarction, M1 macrophages dominate the acute inflammatory phase, whereas M2 macrophages facilitate fibrosis and angiogenesis during tissue repair (17). Recent studies highlight that modulating macrophage polarization to promote M2 polarization-can mitigate I/R injury and improve cardiac function (18,19), offering novel therapeutic strategies for CVDs.
Lactylation, a novel post-translational modification, involves the addition of a lactate group to lysine residues on proteins, linking cellular metabolism to epigenetic regulation (20). Initially identified in macrophages, lactylation has been implicated in various diseases, including cancer, where it modulates tumor microenvironment and immune responses (21), and neurodegenerative disorders, where it influences neuronal survival (22). In CVDs, lactylation plays a critical role in pathological processes such as cardiac hypertrophy, fibrosis, and atherosclerosis. For instance, lactate regulates pathological cardiac hypertrophy via histone lactylation modification (23). Besides, Zhang et al. (24) reveal that alpha-myosin heavy chain lactylation maintains sarcomeric structure and function and alleviates the development of heart failure. Targeting lactylation pathways, such as inhibiting lactate-producing enzymes or modulating lactyltransferases, emerges as a potential therapeutic strategy for CVD (25). These findings underscore lactylation as a pivotal mechanism bridging metabolic dysregulation and cardiovascular pathology, offering new insights for CVD treatment.
Objective
Against this backdrop, this study aimed to investigate whether Rb2 alleviated MIRI by regulating macrophage polarization and explore the underlying molecular mechanisms. Our findings might establish Rb2 as a promising adjunctive therapy for MIRI. We present this article in accordance with the ARRIVE reporting checklist (available at https://cdt.amegroups.com/article/view/10.21037/cdt-2025-406/rc).
Methods
Cell culture, treatment, and transfection
Human cardiomyocytes (AC16; #SCSP-555, ATCC, Manassas, VA, USA) were cultured in Dulbecco’s Modified Eagle Medium (DMEM; #PM150310, Pricella Biotech Co., Ltd. Wuhan, China) supplemented with 10% fetal bovine serum (FBS; #164210-50, Pricella) and 1% penicillin/streptomycin (#PB180120, Pricella) at 37 ℃ in a humidified 5% CO2 atmosphere. Human monocytes (THP-1; #CL-0233, Pricella) were maintained in RPMI-1640 medium (#PM150110, Pricella) containing 10% FBS, 1% penicillin/streptomycin, and 0.05 mM β-mercaptoethanol (#M6250, Sigma-Aldrich, St. Louis, MO, USA). To differentiate THP-1 cells into M0 macrophages, they were treated with 100 ng/mL phorbol 12-myristate 13-acetate (PMA; #P8139, Sigma) for 24 h.
For co-culture experiments, differentiated THP-1-derived macrophages were seeded onto AC16 cells at a 1:2 ratio in DMEM supplemented with 10% FBS. Four Rb2 concentration groups were pre-established: 0 (vehicle control), 25, 50, and 100 µM. The co-culture system was treated with these predetermined concentrations of Rb2 for 24 h to assess dose-dependent effects. Prior to co-culture, AC16 cells were transfected with either an empty vector or an inhibitor of kappa B kinase (IKKα)-overexpressing plasmid using Lipofectamine 3000 (#L3000001, Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s protocol. For each well of a 6-well plate, 3.75 µL of Lipofectamine 3000 reagent was diluted in 125 µL of Opti-MEM medium, while 2.5 µg of plasmid DNA and 5 µL of P3000 reagent were diluted in 125 µL of Opti-MEM medium. The diluted DNA was mixed with diluted Lipofectamine 3000 at a 1:1 ratio, incubated for 15 min at room temperature (RT), and then added to the cells. Following transfection, cells were incubated for 48 h before subsequent experiments. All experiments were performed in triplicate under standardized conditions.
For in vitro experiments, blinding was implemented as follows: all treatments (Rb2 concentrations, transfection conditions) were prepared by an independent researcher who labeled the plates with codes rather than group names. All subsequent assays [Cell Counting Kit-8 (CCK-8), immunofluorescence (IF), reverse transcription quantitative polymerase chain reaction (RT-qPCR), terminal deoxynucleotidyl transferase (TdT) dUTP nick-end labeling (TUNEL), Western blot, immunoprecipitation (IP)] were performed by investigators who were unaware of the treatment assignments. Data analysis was performed by a researcher after the codes were revealed.
Hypoxia/reoxygenation (H/R) cell model
To establish the H/R model, the co-cultured system were incubated in a 96-well plate. The co-culture system was first subjected to hypoxia by incubation in a tri-gas incubator (1% O2, 5% CO2, 94% N2) at 37 ℃ for 24 h in glucose-free DMEM to simulate ischemic conditions. Subsequently, reoxygenation was performed by replacing the medium with normal complete DMEM and returning the cells to a normoxic incubator (95% air, 5% CO2) for 6 h. The control group was maintained under normoxic conditions throughout the experiment. For Rb2 treatment experiments, the four pre-established concentrations (0, 25, 50, and 100 µM) were applied during the 24-h hypoxia period and maintained throughout reoxygenation.
CCK-8
After treatment with different concentrations of Rb2, the co-culture system was incubated with 10 µL of CCK-8 (#96992; Sigma) reagent for 2 h at 37 ℃. Absorbance was measured at 450 nm using a microplate reader (Thermo Fisher). Cell viability was normalized to that of untreated controls. Each condition was tested in triplicate.
IF
Cells were fixed with 4% paraformaldehyde (#441244; Sigma) for 15 min at RT, followed by permeabilization with 0.1% Triton X-100 (#9036-19-5; Sigma) for 10 min. Non-specific binding was blocked with 5% bovine serum albumin (BSA; #10711454001, Merck Millipore, Billerica, MA, USA) in phosphate buffer solution (PBS) for 1 h at RT. Subsequently, the cells were incubated overnight at 4 ℃ with primary antibodies against CD86 (1:100, #ab239075; Abcam, Cambridge, MA, USA) and CD206 (1:500, #13395-1-AP; Proteintech Biotech Co., Ltd. Wuhan, China). After washing with PBS, the samples were incubated with Alexa Fluor-conjugated secondary antibody (1:500, #ab150077; Abcam) for 1 h at RT in the dark. Nuclei were counterstained with 4',6-diamidino-2-phenylindole (DAPI, 1 µg/mL; #D9542, Sigma) for 5 min, and fluorescence images were acquired using a confocal microscope (Leica, Wetzlar, Germany).
RNA extraction and quantification
Total RNA in cells or tissues was isolated using TRIzol reagent (#15596018CN; Thermo Fisher), and its purity and concentration were assessed spectrophotometrically (A260/A280 ratio ≥1.8). Subsequently, 1 µg of RNA was reverse-transcribed into cDNA using the HiScript IV RT SuperMix for qPCR kit (#R423; Vazyme Biotech Co., Ltd. Nanjing, China). RT-qPCR was conducted in triplicate using the SYBR Green Master Mix kit (#Q711; Vazyme) on a real-time PCR system (Thermo Fisher), with β-actin serving as the endogenous control. The thermal cycling conditions included an initial denaturation at 95 ℃ for 30 s, followed by 40 cycles of 95 ℃ for 10 s and 60 ℃ for 30 s. Relative gene expression was calculated using the 2−ΔΔCt method. The used primers were obtained from Genescript Biotech Co., Ltd. (Nanjing, China) and are listed in Table 1.
Table 1
| Name | Forward (5'-3') | Reverse (5'-3') |
|---|---|---|
| TNF-α (human) | CCTCTCTCTAATCAGCCCTCTG | GAGGACCTGGGAGTAGATGAG |
| IL-1β (human) | TTACAGTGGCAATGAGGATGAC | GTGGTGGTCGGAGATTCGTA |
| IL-6 (human) | ACTCACCTCTTCAGAACGAATTG | CCATCTTTGGAAGGTTCAGGTTG |
| TNF-α (mouse) | CAGGCGGTGCCTATGTCTC | CGATCACCCCGAAGTTCAGTAG |
| IL-1β (mouse) | CCTGTGTTTTCCTCCTTGCCT | GCCTAATGTCCCCTTGAATCAA |
| IL-6 (mouse) | CTGCAAGAGACTTCCATCCAG | AGTGGTATAGACAGGTCTGTTGG |
| Arg-1 (human) | GTGGAAACTTGCATGGACAAC | AATCCTGGCACATCGGGAATC |
| IL-10 (human) | GACTTTAAGGGTTACCTGGGTTG | TCACATGCGCCTTGATGTCTG |
| TGF-β (human) | TACAGCACGGTATGCAAGCC | GCAACCGATCTAGCTCACAGAG |
| Arg-1 (mouse) | CTCCAAGCCAAAGTCCTTAGAG | GGAGCTGTCATTAGGGACATCA |
| IL-10 (mouse) | CTTACTGACTGGCATGAGGATCA | GCAGCTCTAGGAGCATGTGG |
| TGF-β (mouse) | CCACCTGCAAGACCATCGAC | CTGGCGAGCCTTAGTTTGGAC |
| IKKα (human) | CTCGGATCCTTTGCTGCTTGATGATGAG | CTCGGAATTCCATTTAATACACAAAGTG |
| β-actin (human) | GTTGTCGACGACGAGCG | GCACAGAGCCTCGCCTT |
| β-actin (mouse) | GGCTGTATTCCCCTCCATCG | CCAGTTGGTAACAATGCCATGT |
Arg-1, arginase-1; IL, interleukin; IKKα, inhibitor of kappa B kinase; RT-qPCR, real-time quantitative polymerase chain reaction; TGF-β, transforming growth factor-β; TNF-α, tumor necrosis factor-α.
TUNEL staining
Cells were fixed in 4% paraformaldehyde for 20 min at RT, permeabilized with 0.1% Triton X-100 for 10 min at 4 ℃, and incubated with commercial TUNEL reaction mix (#C1091; Beyotime Biotech Co., Ltd. Shanghai, China) for 1 h at RT without light. Nuclei were counterstained with DAPI for 5 min, and fluorescence images were acquired via confocal microscopy. TUNEL-positive cells (green fluorescence) and total nuclei (DAPI, blue) were quantified across five random fields per sample using ImageJ.
Animal study
To establish the in vivo MIRI model, 15 healthy male C57BL/6J mice (wild-type, 8–10 weeks old; Vital River, Beijing, China) with specific pathogen-free (SPF) health status were randomly assigned to three experimental groups (n=5 per group): sham, I/R, and I/R + Rb2. The sample size was determined based on a power analysis using preliminary data from our pilot study. Specifically, we anticipated a 25% difference in infarct size between the I/R and I/R + Rb2 groups with a standard deviation (SD) of approximately 15%. To achieve a statistical power of 80% at a significance level of α=0.05 (two-tailed), a minimum of 4 mice per group was required. Considering potential attrition due to surgical failure or mortality during the experimental period, we included 5 mice per group (n=5 per group; total 15 mice). All mice were confirmed to be in good health prior to the experiment. There were no missing data or animal exclusions during the entire experimental period. All 15 mice (5 per group) survived until the scheduled euthanasia time point without meeting any exclusion criteria or humane endpoint criteria. No samples were lost or excluded due to technical issues during tissue processing, staining, or analysis. Therefore, all data from all 15 animals were included in the final statistical analyses
The mice were housed under standardized conditions (12-h light/dark cycle, 22±1 ℃, 50–60% humidity) with free access to standard rodent chow and water. To minimize cage-to-cage variability while preventing potential cross-contamination from Rb2 treatment (administered intraperitoneally), mice from different experimental groups were housed in separate cages (3 cages total, with 5 mice per cage), but all cages were placed in the same ventilated rack within the same room to ensure identical environmental conditions. Each cage was clearly labeled with the group designation, and cage positions were rotated weekly to minimize location effects.
Blinding procedure: the experiment was performed in a blinded manner at multiple stages. Group allocation was performed by a researcher who was not involved in subsequent surgical procedures or data collection. The surgeon who performed the left anterior descending (LAD) ligation and Rb2 administration was aware of the group allocation due to the nature of the surgical intervention and drug administration. However, all outcome assessments were conducted by investigators blinded to group assignment. Specifically, echocardiography was performed and analyzed by a researcher, who was unaware of the treatment groups. Tissue collection, TTC staining, IHC staining, and image analyses were carried out by two researchers both of whom were blinded to group allocation. Serum cTnT measurements by enzyme-linked immunosorbent assay (ELISA) were performed by an independent technician who had no knowledge of the experimental design. RT-qPCR analyses were conducted by a researcher, who was blinded to the sample identities until after data acquisition. The blinding codes were revealed only after all data had been collected and preliminary analyses were completed.
For I/R induction, mice were anesthetized with 2% isoflurane (#HY-A0134; MedChem Express, Monmouth Junction, NJ, USA), intubated, and subjected to transient occlusion of the LAD coronary artery using an 8-0 Prolene suture for 30 min, followed by 24 h of reperfusion. After reperfusion, the chest was surgically closed with 6-0 Prolene sutures, and the endotracheal tube was removed to allow spontaneous respiration. Following surgery, mice were placed on a heating pad until fully recovered from anesthesia. To alleviate postoperative pain, all surgically operated mice (I/R and I/R + Rb2 groups) received subcutaneous injections of the analgesic buprenorphine (0.05 mg/kg) immediately after awakening and every 12 h thereafter. The sham-operated mice underwent identical surgical procedures except for LAD ligation. Before ischemia, mice in the I/R + Rb2 group received daily intraperitoneal injections of Rb2 (10 mg/kg; #HY-N0040R; purity: ≥98%; MedChem Express) for 14 consecutive days (26). During the entire experimental period (including the 14-day pre-treatment stage and up to the end of the experiment), body weight and food intake were measured and recorded twice a week. Finally, calculate the average feed intake during the entire experimental period.
Post reperfusion, cardiac function was evaluated using transthoracic echocardiography (Vevo 2100) to determine left ventricular ejection fraction (LVEF, %) and left ventricular fractional shortening (LVFS, %). Subsequently, mice were euthanized via 4% isoflurane overdose. Final body weight was recorded, and blood samples were collected via cardiac puncture. Serum was obtained by centrifugation (3,000 ×g, 15 min, 4 ℃) and stored at −80 ℃ for ELISA analysis. The heart tissues were harvested, and the ischemic border zone was identified and dissected: after LAD ligation-induced I/R, the ischemic border zone was defined as the transitional area between the infarcted myocardium [pale region, identified by subsequent triphenyltetrazolium chloride (TTC) staining] and the normal myocardium (red region). Tissues from this ischemic border zone were used for infarct size assessment (TTC staining), immunohistochemistry (IHC), and RNA quantification assays. All experimental protocols were approved by the Ethics Committee of MDKN Biotechnology Co., Ltd. (No. MDKN-2024-397), in compliance with national guidelines for the care and use of animals. All methods were carried out in accordance with relevant guidelines and regulations. A detailed study protocol outlining the research objectives, experimental design, methodology, and statistical analysis plan was prepared prior to the commencement of the research; however, it was not registered in a public repository.
ELISA
A commercial ELISA kit was obtained from COIBI Biotech Co., Ltd. (Shanghai, China) to analyze the concentration of cardiac troponin T (cTnT; #CB10716-Mu) in serum of rats. All protocols were carried out following the manufacturer’s provided instructions. Subsequently, optical density (OD) value of each well was measured via the microplate reader (Thermo Fisher). The acquired outcomes were then adjusted based on the total protein concentration in each sample to enable comparison between samples.
TTC staining
Following euthanasia, hearts were rapidly excised, rinsed in PBS, and frozen at −20 ℃ for 20 min. The ventricles were transversely sliced into 2-mm sections using a sterile blade. Sections were incubated in 1% TTC (#C0652; Beyotime) dissolved in PBS (pH 7.4) at 37 ℃ for 30 min without light, with gentle agitation every 5 min to ensure uniform staining. Viable myocardium stained red due to formazan precipitation, while infarcted areas remained pale. Tissues were then fixed in 4% paraformaldehyde for 1 h, photographed under standardized lighting.
IHC
Heart tissues from the ischemic border zone were fixed in 4% paraformaldehyde for 24 h, dehydrated in graded ethanol, and embedded in paraffin. Sections (5 µm) were deparaffinized, rehydrated, and subjected to antigen retrieval in citrate buffer (pH 6.0) at 95 ℃ for 20 min. Endogenous peroxidase activity was quenched with 3% H2O2, followed by blocking in 5% BSA for 1 h at RT. Sections were incubated overnight at 4 ℃ with primary antibodies against CD86 (1:100; #PA5-114995, Thermo Fisher) or CD206 (1:300; #24595, Cell Signaling Technology, Danvers, MA, USA), then treated with secondary antibody (1:1,000; #ab6721, Abcam) for 1 h at 37 ℃. Signal detection used 3,3'-diaminobenzidine (DAB) substrate (#D8001, Sigma), and nuclei were counterstained with hematoxylin. Slides were imaged using a light microscope.
Bioinformatics analysis
The GSE4105 dataset was obtained from the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/). Data analysis was performed using R language, with P<0.05 and |log2(fold change)| >1 as thresholds for identifying differentially expressed genes (DEGs). Volcano plots visualized DEG distribution between sham and IR samples, where red dots indicated upregulated genes, blue dots denoted downregulated genes, and grey dots represented non-significant genes. Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis was employed to assess signaling pathways. PharmMapper server (https://www.lilab-ecust.cn/pharmmapper/index.html) was used to analyze the pharmacological targets of Rb2. The Search Tool for the Retrieval of Interacting Genes/Proteins (STRING) database (https://cn.string-db.org/) was used to analyze the interacting proteins of IKKα. The Cytoscape V3.9.1 software was used to construct the protein-protein interactions (PPIs) network diagram of drug-target genes-disease. The DeepKla database (http://lin-group.cn/server/DeepKla/Serve.html) was used to predict lactylation modification sites in IKKα.
Molecular docking
Molecular docking was used to analyze the action mode of Rb2 and the target protein IKKα. The Rb2 molecular structure of this docking was obtained from the PubChem database (https://pubchem.ncbi.nlm.nih.gov/). The IKKα protein structure IKKA (PDB ID: 5EBZ) was obtained from the RCSB Protein Data Bank database (https://www.rcsb.org/). The molecular docking was performed by the Glide module in Schrodinger Maestro software. Finally, the mode of action of the compound and the target protein was analyzed, and the interaction between the compound and the protein residue was obtained.
Western blot
Cells were lysed in RadioImmunoPrecipitation Assay buffer (RIPA) buffer (#R0278; Sigma) containing protease inhibitors, and protein concentrations were determined using the Bradford assay (#TP0100; Sigma). Equal amounts of protein (30 µg) were separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene fluoride (PVDF) membranes (#182702; Sigma). After blocking with 5% skim milk for 1 h at RT, membranes were incubated overnight at 4 ℃ with primary antibodies against IKKα (1:1,000; #ab32041, Abcam) and pan-lactylation (1:1,000; #PTM-1401, PTM Biolabs, Hangzhou, China). β-actin (1:5,000; #ab8227, Abcam) served as the loading control. Following Tris-Buffered Saline with Tween® 20 (TBST) washes, membranes were incubated with HRP-conjugated secondary antibodies (1:5,000; #ab205718, Abcam) for 1 h at 25 ℃. Protein bands were visualized using enhanced chemiluminescence (#P0018S, Beyotime) and quantified via ImageJ.
IP
IP assay combined with Western blot were used to access the lactylation level of IKKα in co-culture system. Briefly, co-culture system lysates was immunoprecipitated with anti-IKKα antibody (1:60; #ab32041, Abcam) and protein A/G agarose (#P2055, Beyotime), followed by Western blot against lactylation.
Surface plasmon resonance (SPR) assay
The binding assays based on SPR technology were performed in a Biacore 8K instrument (GE Healthcare, Chicago, IL, USA) at 25 ℃ using PBST (PBS, pH 7.4, containing 0.005% Tween-20) as the running buffer. The protein sample was dissolved in coupling buffer [20 µg/mL in 10 mM sodium acetate (pH 5.0)] and then immobilized onto a CM5 chip that had been equilibrated with PBST overnight. Rb2 (1.25 µM) was serially diluted and then injected at a flow rate of 30 µL/min for 90 s (contact phase), followed by 90 s (dissociation phase). The binding data were collected using Biacore 8K evaluation software (GE Healthcare).
Protein stability assessment
The co-culture system was treated with cycloheximide (CHX, 100 µg/mL, Abcam), a protein translation inhibitor, the protein levels of IKKα at different time points (0, 6, 12, and 24 h) were assessed by Western blot.
Statistical analysis
The SPSS 21.0 software was used to analyze data. Data are expressed as mean ± SD. All data in this study conform to the normal distribution. Student’s t-test was used for comparison between the two groups. One-way analysis of variance (ANOVA) with Tukey’s post hoc analysis was used for comparison among groups. Statistical analyses were performed using GraphPad Prism software (v8.0.1, GraphPad Software Inc., San Diego, CA, USA). P<0.05 indicates that the difference is statistically significant.
Results
Rb2 treatment enhanced viability in the THP-1/AC16 co-culture system
To assess its effects on cell viability, the THP-1/AC16 co-culture system was treated with increasing concentrations of Rb2 (0, 25, 50, and 100 µM). In the control group, 100 µM Rb2 reduced cell viability, whereas in the H/R group, Rb2 treatment at 25, 50, and 100 µM increased viability compared to the untreated (0 µM) condition (Figure 1). Among the two lower concentrations that showed protective effects without evident toxicity in control cells (25 and 50 µM), we observed that 50 µM Rb2 produced a more pronounced increase in cell viability under H/R conditions compared to 25 µM (P<0.05). Additionally, while 100 µM Rb2 also enhanced viability in H/R-treated cells, it exhibited cytotoxic effects in normoxic control cells, suggesting a potential narrow therapeutic window. Therefore, to maximize the protective effect while avoiding the risk of toxicity, the 50 µM concentration was selected for all subsequent mechanistic experiments. This dose selection approach aligns with standard practice in natural compound research, where the optimal concentration is chosen based on both efficacy and safety profiles. A concentration of 50 µM Rb2 was selected for subsequent experiments.
Rb2 altered macrophage polarization in H/R-treated THP-1/AC16 co-culture system
IF results revealed that the H/R group exhibited increased CD86 (M1 marker) and decreased CD206 (M2 marker) expression compared to the control group, whereas Rb2 treatment reversed these changes (Figure 2A). RT-qPCR analysis showed that pro-inflammatory cytokines [interleukin (IL)-1β, tumor necrosis factor-α (TNF-α), IL-6] were upregulated and anti-inflammatory markers [arginase-1 (Arg-1), IL-10, transforming growth factor-β (TGF-β)] were downregulated in the H/R group relative to controls, with Rb2 treatment restoring these gene expression patterns (Figure 2B). Additionally, TUNEL staining demonstrated a significant increase in apoptotic cell percentage in the H/R group compared to controls, which was attenuated by Rb2 treatment in the co-culture system (Figure 2C). These findings indicated that Rb2 promoted macrophage polarization toward the anti-inflammatory M2 phenotype and reduced H/R-induced apoptosis.
Rb2 attenuated MIRI by modulating macrophage polarization and cardiac function in mice
To further investigate the cardioprotective effects of Rb2 in vivo, we established a murine I/R model. We first monitored the average body weight and food intake of the mice throughout the experimental period. These parameters demonstrated no significant differences among the sham, I/R, and I/R + Rb2 groups (Figure 3A,3B). We then evaluated specific markers of cardiac injury. ELISA analysis revealed a significant elevation in cardiac cTnT level in the I/R group compared to the sham group, whereas Rb2 treatment markedly reduced cTnT level (Figure 3C). Transthoracic echocardiography demonstrated that I/R injury impaired cardiac function, as evidenced by decreased LVEF and LVFS in the I/R group relative to sham-operated mice. However, Rb2 administration significantly improved these functional parameters (Figure 3D-3F). Consistent with these findings, TTC staining confirmed a larger percentage of area at risk (AAR) and infarct size in the I/R group compared to the sham group, while Rb2 treatment substantially reduced AAR percentage and infarct size (Figure 3G-3I). IHC analysis further revealed an increased expression of the pro-inflammatory marker CD86 and a decreased expression of the anti-inflammatory marker CD206 in I/R-injured hearts, which were partially reversed by Rb2 treatment (Figure 3J). Moreover, RT-qPCR results indicated that I/R injury upregulated the mRNA levels of pro-inflammatory cytokines (IL-1β, TNF-α, IL-6) while downregulating anti-inflammatory markers (Arg-1, IL-10, TGF-β) in cardiac tissues. Rb2 treatment effectively counteracted these inflammatory changes (Figure 3K,3L). These findings demonstrated that Rb2 exerted cardioprotective effects against I/R injury by mitigating myocardial damage, improving cardiac function, and modulating macrophage polarization.
Rb2 inhibited IKKα lactylation at K617 and destabilized its protein in THP-1/AC16 co-culture system
To identify key molecular alterations in MIRI, we performed comprehensive analysis of the GSE4105 dataset, which revealed significant DEGs between sham and I/R groups (Figure 4A). Subsequent KEGG enrichment analysis demonstrated that these DEGs were predominantly involved in glutathione metabolism, nuclear factor kappa B (NF-κB) signaling pathway, and fatty acid elongation, among other critical pathways (Figure 4B). This finding aligns with existing literature reporting NF-κB activation as a hallmark of I/R injury (27). Focusing specifically on genes within the NF-κB pathway, we employed the PharmMapper server to identify potential pharmacological targets of Rb2, yielding 165 Rb2-targeted genes. Comparative analysis through Venn diagram revealed seven overlapping genes between the PharmMapper-derived targets and GSE4105-identified DEGs (Figure 4C). Notably, among these shared genes, IKKα emerged as particularly significant as it was not only common to both datasets but also functionally associated with the NF-κB pathway. This dual relevance prompted our selection of IKKα as the primary focus for subsequent investigations. PPI analysis using the STRING database further elucidated the molecular network surrounding IKKα (Figure 4D), while a comprehensive drugs-genes-diseases network map illustrated the complex relationships between Rb2, multiple genetic components, and MIRI (Figure 4E). Molecular docking simulations predicted stable binding between Rb2 and IKKα, mediated by hydrogen and hydrophobic interactions (Figure 4F), which was further validated by SPR assays confirming a direct Rb2-IKKα interactio4n (Figure 4G). I/R injury leads to metabolic disorders, and ischemia hypoxia leads to the production of a large amount of lactic acid in tissues (28). Thus, we hypothesized that I/R might affect the lactylation level of IKKα. Western blot and IP analyses revealed that H/R upregulated IKKα and lactylated IKKα (IKKα-kla) levels compared to the control group (Figure 4H). Using the DeepKla database, we identified four potential lactylation sites (K240, K615, K617, and K624) on IKKα (Figure 4I). Subsequent mutagenesis studies demonstrated that mutation at K617, but not other sites, markedly reduced both IKKα and IKKα-Kla protein levels (Figure 4J). Additionally, protein stability assay showed that IKKα protein stability increased after 6, 12, and 24 h of CHX treatment under H/R condition, whereas Rb2 treatment reversed this effect (Figure 4K). These findings suggested that Rb2 could directly bind to IKKα, inhibiting its lactylation at K617, and destabilizing the protein in THP-1/AC16 co-culture system.
IKKα overexpression inhibited M2 macrophage polarization in H/R-treated THP-1/AC16 co-culture system
To further investigate the role of IKKα in H/R, we transfected an IKKα overexpression vector into the co-culture system. The results demonstrated that IKKα overexpression increased IKKα mRNA level compared to the control or empty vector groups (Figure 5A). Furthermore, relative to the H/R + Rb2 + vector group, IKKα overexpression reduced cell viability and downregulated the expression of the M2 macrophage marker CD206 along with anti-inflammatory mediators (Arg-1, IL-10, TGF-β), while enhancing CD86 expression, elevating pro-inflammatory cytokine (IL-1β, TNF-α, IL-6) mRNA levels, and increasing the percentage of TUNEL-positive apoptotic cells in the co-culture system (Figure 5B-5E).
Discussion
Main findings
The present study demonstrates that Rb2 exerts cardioprotective effects against MIRI by modulating macrophage polarization through a previously unrecognized mechanism involving IKKα lactylation. Using both in vitro H/R-challenged THP-1/AC16 co-culture system and in vivo murine MIRI model, we found that Rb2 treatment: (I) enhanced cell viability and reduced apoptosis; (II) promoted phenotypic shift from pro-inflammatory M1 to anti-inflammatory M2 macrophages, as evidenced by decreased CD86 expression and pro-inflammatory cytokines (IL-1β, TNF-α, IL-6) alongside increased CD206 expression and anti-inflammatory mediators (Arg-1, IL-10, TGF-β); (III) improved cardiac function (increased LVEF and LVFS), reduced infarct size, and decreased serum cTnT levels in I/R mice. Mechanistically, we identified IKKα as a direct binding target of Rb2 through molecular docking and SPR assays. Rb2 specifically inhibited IKKα lactylation at lysine 617 (K617), leading to IKKα protein destabilization and subsequent suppression of NF-κB signaling, thereby promoting M2 polarization. The functional relevance of IKKα was confirmed by overexpression experiments, which reversed the protective effects of Rb2. These findings establish a novel link between protein lactylation and macrophage polarization in MIRI and position IKKα as a key molecular switch targeted by Rb2.
Strengths and limitations
Novelty and strengths: this study presents several significant advances. First, it is the first to demonstrate that Rb2 directly binds to IKKα and inhibits its lactylation at the K617 site, thereby promoting M2 macrophage polarization. Second, we elucidate a previously unknown mechanism by which lactylation regulates IKKα protein stability, linking metabolic reprogramming (lactate accumulation during ischemia) to inflammatory signaling in MIRI. Third, comprehensive in vivo validation with 14-day Rb2 pretreatment shows significant improvement in cardiac function and reduction in infarct size, supporting the translational potential of Rb2. Fourth, the use of multiple orthogonal approaches—molecular docking, SPR, site-directed mutagenesis, and protein stability assays—provides robust evidence for the specificity of Rb2-IKKα interaction and the critical role of K617 lactylation.
Limitations: several limitations of this study should be acknowledged. First, while we have identified that Rb2 inhibits IKKα lactylation at K617, the precise molecular mechanism by which this site-specific modification regulates downstream macrophage polarization remains incompletely elucidated—including how lactylation affects IKKα conformation, kinase activity, or interactions with NF-κB pathway components. Second, the absence of a “Sham + Rb2” control group in the in vivo study limits our ability to definitively exclude potential physiological or toxic effects of Rb2 itself on normal cardiac tissue. Third, although we established the core molecular mechanism in vitro, direct validation of IKKα K617 lactylation modulation by Rb2 in ischemic myocardial tissues is lacking due to technical challenges, including the limited availability of site-specific antibodies. Fourth, the lactyltransferase(s) responsible for IKKα K617 lactylation remain unidentified. Fifth, the 14-day pretreatment regimen used may not reflect clinically relevant post-ischemic administration, and the observed biphasic in vitro dose-response (with 100 µM reducing viability in normoxic controls) warrants further in vivo dose optimization. Sixth, the study focused primarily on macrophage polarization, leaving potential contributions from other cell types (endothelial cells, fibroblasts, cardiomyocytes) unexplored. Finally, the relatively small sample size (n=5 per group), while statistically justified, would benefit from validation in larger cohorts. Future studies addressing these limitations will strengthen the translational relevance of our findings.
Comparison with similar studies
Our findings align with and extend previous research on ginsenosides in cardiovascular protection. The role of macrophage polarization in MIRI is well-established, with M1 macrophages exacerbating inflammation and M2 promoting repair (15-17). Several studies have reported that ginsenosides modulate macrophage function. Jia et al. (29) showed that Shuangshen Ningxin Capsule, containing ginsenoside Rg1, Rb1, and Rb2, attenuates MIRI by inhibiting excessive mitochondrial autophagy. Wang et al. (11) demonstrated that Rb2 ameliorates atherosclerosis by counteracting miR-216a-mediated M1 polarization via the Smad3/NF-κB inhibitor alpha pathway. Xu et al. (30) reported that Rg1 reduces cardiac inflammation during MIRI by inhibiting M1 polarization. Other natural compounds, such as resveratrol and baicalin, similarly promote M2 polarization to mitigate cardiac injury (31,32). However, none of these studies explored the role of protein lactylation—a post-translational modification linking metabolism to inflammation. Our work uniquely identifies IKKα lactylation as a critical regulatory node and demonstrates that Rb2 directly interferes with this modification. This mechanistic insight distinguishes our study from previous reports and provides a new dimension to understanding how ginsenosides exert anti-inflammatory effects.
Recent advances in lactylation research have implicated this modification in various cardiovascular pathologies. Zhao et al. (23,24) reported that lactate regulates pathological cardiac hypertrophy via histone lactylation. Zhang et al. (23,24) showed that α-myosin heavy chain lactylation maintains sarcomeric structure in heart failure. In the context of MIRI, Fang et al. (33) demonstrated that LDHA promotes injury by enhancing NLRP3 lactylation at K245, inducing pyroptosis. Our study complements these findings by revealing that non-histone protein lactylation (IKKα) also plays a key role in MIRI, and that targeting this modification with a natural compound like Rb2 can shift macrophage polarization toward a protective phenotype. Interestingly, while lactate administration has been shown to reduce brain injury in neonatal hypoxia-ischemia (34). our results suggest that in the heart, inhibiting specific protein lactylation (rather than global lactate elevation) may be beneficial—highlighting the context-dependent nature of lactylation signaling.
Interpretation of the findings
The identification of IKKα lactylation at K617 as a key event in MIRI provides a mechanistic link between the metabolic hallmark of ischemia—lactate accumulation—and the inflammatory response that drives reperfusion injury. During ischemia, anaerobic glycolysis leads to lactate buildup, which can drive protein lactylation (20). Our data show that H/R upregulates both IKKα protein and its lactylation levels. Rb2 binding to IKKα inhibits lactylation at K617, leading to protein destabilization (as shown by CHX chase assay) and reduced IKKα levels. Since IKKα is a critical activator of NF-κB signaling, its destabilization dampens pro-inflammatory gene expression and promotes M2 polarization. This mechanism explains how Rb2 can simultaneously reduce inflammation and improve cardiac function.
The dose-dependent effects observed in our study warrant further interpretation. The biphasic response—where 25–50 µM Rb2 is protective under H/R but 100 µM reduces viability in normoxic controls—is consistent with the concept of hormesis, a phenomenon frequently observed with bioactive natural products (35). Several factors may contribute: (I) at high concentrations, ginsenosides can intercalate into cell membranes, disrupting fluidity and causing non-specific effects (36); (II) stressed cells may have altered drug metabolism or signaling thresholds compared to healthy cells; (III) excessive IKKα inhibition might compromise essential basal NF-κB functions required for cell survival under normal conditions. This hormetic pattern underscores the importance of precise dose optimization and suggests that the therapeutic window for Rb2 in MIRI may be relatively narrow—a critical consideration for future clinical development.
The specificity of Rb2 for IKKα K617 lactylation is supported by mutagenesis studies showing that mutation of K617, but not other predicted sites (K240, K615, K624), abolished lactylation and reduced protein stability. This site-specific regulation implies that K617 lactylation may serve as a molecular switch controlling IKKα turnover. Future structural studies could reveal how lactylation at this particular lysine affects IKKα conformation and interactions with its binding partners (e.g., NEMO, substrates). Moreover, since lactylation is a reversible modification, identifying the “erasers” (demodifying enzymes) that remove lactyl groups from IKKα could provide additional therapeutic avenues.
Implications and required actions
Our findings have several important implications. From a therapeutic perspective, Rb2 emerges as a promising candidate for MIRI treatment. Its ability to modulate a key post-translational modification (lactylation) and shift macrophage polarization toward a reparative phenotype offers a novel strategy that complements existing reperfusion therapies. The fact that Rb2 is a natural compound from Panax ginseng, with a long history of safe use in traditional medicine, may facilitate its clinical translation. However, rigorous preclinical studies—including pharmacokinetic profiling, toxicity assessment, and efficacy testing in clinically relevant models (e.g., post-ischemic administration)—are needed before human trials can be considered.
From a mechanistic standpoint, this study establishes IKKα lactylation as a previously unrecognized regulatory node in MIRI. This opens new research directions: (I) identifying the lactyltransferase(s) that modify IKKα; (II) exploring whether other components of the NF-κB pathway (e.g., IKKβ, NEMO, p65) are similarly regulated by lactylation; (III) investigating whether lactylation of IKKα occurs in other inflammatory diseases (e.g., atherosclerosis, heart failure, sepsis) and whether targeting it with Rb2 or other compounds could have broader therapeutic applications. Additionally, our work highlights the potential of targeting protein lactylation—a rapidly emerging field—in cardiovascular medicine.
Future studies should also address the cell-type-specific roles of IKKα lactylation. While we focused on macrophages, cardiomyocytes themselves may also undergo lactylation changes that influence their survival. Conditional knockout mice lacking IKKα specifically in myeloid cells versus cardiomyocytes could dissect these contributions. Moreover, long-term studies examining whether Rb2 treatment post-MI improves chronic remodeling and heart failure outcomes would strengthen its therapeutic relevance. Finally, given the hormetic dose-response, careful phase I trials to establish the safe and effective dose range in humans will be essential.
Conclusions
In conclusion, this study reveals a novel mechanism by which Rb2 protects against MIRI through IKKα lactylation-dependent regulation of macrophage polarization. By inhibiting lactylation at K617, Rb2 destabilizes IKKα, suppresses NF-κB signaling, and promotes an anti-inflammatory M2 phenotype, ultimately reducing cardiomyocyte apoptosis and improving cardiac function. These findings not only position Rb2 as a promising therapeutic candidate for MIRI but also highlight lactylation as a potential target for cardiovascular drug development. The work underscores the value of exploring natural compounds for their ability to modulate post-translational modifications and opens new avenues for treating ischemic heart disease.
Acknowledgments
None.
Footnote
Reporting Checklist: The authors have completed the ARRIVE reporting checklist. Available at https://cdt.amegroups.com/article/view/10.21037/cdt-2025-406/rc
Data Sharing Statement: Available at https://cdt.amegroups.com/article/view/10.21037/cdt-2025-406/dss
Peer Review File: Available at https://cdt.amegroups.com/article/view/10.21037/cdt-2025-406/prf
Funding: The work was supported by
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://cdt.amegroups.com/article/view/10.21037/cdt-2025-406/coif). The authors have no conflicts of interest to declare.
Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. All experimental protocols were approved by the Ethics Committee of MDKN Biotechnology Co., Ltd. (No. MDKN-2024-397), in compliance with national guidelines for the care and use of animals. All methods were carried out in accordance with relevant guidelines and regulations.
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Zhou M, Yu Y, Luo X, et al. Myocardial Ischemia-Reperfusion Injury: Therapeutics from a Mitochondria-Centric Perspective. Cardiology 2021;146:781-92. [Crossref] [PubMed]
- Murphy A, Goldberg S. Mechanical Complications of Myocardial Infarction. The American Journal of Medicine 2022;135:1401-09. [Crossref] [PubMed]
- Fede MS, Daziani G, Tavoletta F, et al. Myocardial Ischemia/Reperfusion Injury: Molecular Insights, Forensic Perspectives, and Therapeutic Horizons. Cells 2025;14:1509. [Crossref] [PubMed]
- Qin GW, Lu P, Peng L, et al. Ginsenoside Rb1 Inhibits Cardiomyocyte Autophagy via PI3K/Akt/mTOR Signaling Pathway and Reduces Myocardial Ischemia/Reperfusion Injury. Am J Chin Med 2021;49:1913-27. [Crossref] [PubMed]
- Xu S, Wu B, Zhong B, et al. Naringenin alleviates myocardial ischemia/reperfusion injury by regulating the nuclear factor-erythroid factor 2-related factor 2 (Nrf2) /System xc-/ glutathione peroxidase 4 (GPX4) axis to inhibit ferroptosis. Bioengineered 2021;12:10924-34. [Crossref] [PubMed]
- Wang D, Wang D, Jin Q, et al. Suxiao Jiuxin Pill alleviates myocardial ischemia/reperfusion-induced autophagy via miR-193a-3p/ALKBH5 pathway. Phytomedicine 2024;125:155359. [Crossref] [PubMed]
- Shah MA, Abuzar SM, Ilyas K, et al. Ginsenosides in cancer: Targeting cell cycle arrest and apoptosis. Chem Biol Interact 2023;382:110634. [Crossref] [PubMed]
- Kang HS, Lim HK, Jang WY, et al. Anti-Colorectal Cancer Activity of Panax and Its Active Components, Ginsenosides: A Review. Int J Mol Sci 2025;26:2593. [Crossref] [PubMed]
- Piao XM, Huo Y, Kang JP, et al. Diversity of Ginsenoside Profiles Produced by Various Processing Technologies. Molecules 2020;25:4390. [Crossref] [PubMed]
- Oh JM, Jeong JH, Park SY, et al. Ginsenoside Compound K Induces Adult Hippocampal Proliferation and Survival of Newly Generated Cells in Young and Elderly Mice. Biomolecules 2020;10:484. [Crossref] [PubMed]
- Wang S, Yang S, Chen Y, et al. Ginsenoside Rb2 Alleviated Atherosclerosis by Inhibiting M1 Macrophages Polarization Induced by MicroRNA-216a. Front Pharmacol 2021;12:764130. [Crossref] [PubMed]
- Peng Y, Liao B, Zhou Y, et al. Ginsenoside Rb2 improves heart failure by down-regulating miR-216a-5p to promote autophagy and inhibit apoptosis and oxidative stress. J Appl Biomed 2023;21:180-92. [Crossref] [PubMed]
- Ramli FF, Ali A, Ibrahim N. '. Molecular-Signaling Pathways of Ginsenosides Rb in Myocardial Ischemia-Reperfusion Injury: A Mini Review. Int J Med Sci 2022;19:65-73. [Crossref] [PubMed]
- Boutilier AJ, Elsawa SF. Macrophage Polarization States in the Tumor Microenvironment. Int J Mol Sci 2021;22:6995. [Crossref] [PubMed]
- Cutolo M, Campitiello R, Gotelli E, et al. The Role of M1/M2 Macrophage Polarization in Rheumatoid Arthritis Synovitis. Front Immunol 2022;13:867260. [Crossref] [PubMed]
- Hou P, Fang J, Liu Z, et al. Macrophage polarization and metabolism in atherosclerosis. Cell Death Dis 2023;14:691. [Crossref] [PubMed]
- Kim Y, Nurakhayev S, Nurkesh A, et al. Macrophage Polarization in Cardiac Tissue Repair Following Myocardial Infarction. Int J Mol Sci 2021;22:2715. [Crossref] [PubMed]
- Xu X, Gao W, Li L, et al. Annexin A1 protects against cerebral ischemia-reperfusion injury by modulating microglia/macrophage polarization via FPR2/ALX-dependent AMPK-mTOR pathway. J Neuroinflammation 2021;18:119. [Crossref] [PubMed]
- Zhang FL, Hu Z, Wang YF, et al. Organoids transplantation attenuates intestinal ischemia/reperfusion injury in mice through L-Malic acid-mediated M2 macrophage polarization. Nat Commun 2023;14:6779. [Crossref] [PubMed]
- Gong H, Zhong H, Cheng L, et al. Post-translational protein lactylation modification in health and diseases: a double-edged sword. J Transl Med 2024;22:41. [Crossref] [PubMed]
- Li H, Sun L, Gao P, et al. Lactylation in cancer: Current understanding and challenges. Cancer Cell 2024;42:1803-7. [Crossref] [PubMed]
- Zhao A, Xu W, Han R, et al. Role of histone modifications in neurogenesis and neurodegenerative disease development. Ageing Res Rev 2024;98:102324. [Crossref] [PubMed]
- Zhao SS, Liu J, Wu QC, et al. Lactate regulates pathological cardiac hypertrophy via histone lactylation modification. J Cell Mol Med 2024;28:e70022. [Crossref] [PubMed]
- Zhang N, Zhang Y, Xu J, et al. α-myosin heavy chain lactylation maintains sarcomeric structure and function and alleviates the development of heart failure. Cell Res 2023;33:679-98. [Crossref] [PubMed]
- Zhu W, Guo S, Sun J, et al. Lactate and lactylation in cardiovascular diseases: current progress and future perspectives. Metabolism 2024;158:155957. [Crossref] [PubMed]
- Huang Q, Yao Y, Wang Y, et al. Ginsenoside Rb2 inhibits p300-mediated SF3A2 acetylation at lysine 10 to promote Fscn1 alternative splicing against myocardial ischemic/reperfusion injury. J Adv Res 2024;65:365-79. [Crossref] [PubMed]
- Li X, Qiao M, Zhou Y, et al. Modulating the RPS27A/PSMD12/NF-κB pathway to control immune response in mouse brain ischemia-reperfusion injury. Mol Med 2024;30:106. [Crossref] [PubMed]
- Cheng X, Wang K, Zhao Y, et al. Research progress on post-translational modification of proteins and cardiovascular diseases. Cell Death Discov 2023;9:275. [Crossref] [PubMed]
- Jia F, Chen Y, Xin G, et al. Shuangshen Ningxin capsule alleviates myocardial ischemia-reperfusion injury in miniature pigs by modulating mitophagy: network pharmacology and experiments in vivo. Chin Med 2023;18:120. [Crossref] [PubMed]
- Xu X, Wu Q, Pei K, et al. Ginsenoside Rg1 reduces cardiac inflammation against myocardial ischemia/reperfusion injury by inhibiting macrophage polarization. J Ginseng Res 2024;48:570-80. [Crossref] [PubMed]
- Xu M, Li X, Song L. Baicalin regulates macrophages polarization and alleviates myocardial ischaemia/reperfusion injury via inhibiting JAK/STAT pathway. Pharm Biol 2020;58:655-63. [Crossref] [PubMed]
- Ma S, Fan L, Li J, et al. Resveratrol promoted the M2 polarization of microglia and reduced neuroinflammation after cerebral ischemia by inhibiting miR-155. Int J Neurosci 2020;130:817-25. [Crossref] [PubMed]
- Fang L, Yu Z, Qian X, et al. LDHA exacerbates myocardial ischemia-reperfusion injury through inducing NLRP3 lactylation. BMC Cardiovasc Disord 2024;24:651. [Crossref] [PubMed]
- Tassinari ID, Andrade MKG, da Rosa LA, et al. Lactate Administration Reduces Brain Injury and Ameliorates Behavioral Outcomes Following Neonatal Hypoxia-Ischemia. Neuroscience 2020;448:191-205. [Crossref] [PubMed]
- Calabrese EJ. Hormesis: a fundamental concept in biology. Microb Cell 2014;1:145-9. [Crossref] [PubMed]
- Qi LW, Wang CZ, Yuan CS. Ginsenosides from American ginseng: chemical and pharmacological diversity. Phytochemistry 2011;72:689-99. [Crossref] [PubMed]

